Quick Order

pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)

    DatasheetReviewsRelated ProductsProtocols
    • Positive control for the pCMV / hygro-Myc.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag) Physical Map

     
    Description
     Vector Name pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag)
     Vector Size 6338bp
     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Ampicillin
     Selection In Mammalian Cells Hygromycin
     Protein Tag GAGCAGAAACTCATCTCAGAAGAGGATCTG
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)

     

     
    pCMV / hygro-Positive Control Vector (C-terminal Fc-Myc tag) Sequence and Quality Control

     

    1        ATGGGCTGGT CCTGCATCAT CCTGTTCCTC GTGGCGACCG CGACCGGGGT CCACAGC1GAG
    61       CCCAAATCTT CTGACAAAAC TCACACATGC CCACCGTGCC CAGCACCTGA ACTCCTGGGG
    121      GGACCGTCAG TCTTCCTCTT CCCCCCAAAA CCCAAGGACA CCCTCATGAT CTCCCGGACC
    181      CCTGAGGTCA CGTGCGTGGT GGTGGACGTG AGCCACGAAG ACCCCGAGGT CAAGTTCAAC
    241      TGGTACGTGG ACGGCGTGGA GGTGCATAAT GCCAAGACAA AGCCGCGGGA GGAGCAGTAC
    301      AACAGCACGT ACCGTGTGGT CAGCGTCCTC ACCGTCCTGC ACCAGGACTG GCTGAATGGC
    361      AAGGAGTACA AGTGCAAGGT CTCCAACAAA GCCCTCCCAG CCCCCATCGA GAAAACCATC
    421      TCCAAAGCCA AAGGGCAGCC CCGAGAACCA CAGGTGTACA CCCTGCCCCC ATCCCGGGAT
    481      GAGCTGACCA AGAACCAGGT CAGCCTGACC TGCCTGGTCA AAGGCTTCTA TCCCAGCGAC
    541      ATCGCCGTGG AGTGGGAGAG CAATGGGCAG CCGGAGAACA ACTACAAGAC CACGCCTCCC
    601      GTGCTGGACT CCGACGGCTC CTTCTTCCTC TACAGCAAGC TCACCGTGGA CAAGAGCAGG
    661      TGGCAGCAGG GGAACGTCTT CTCATGCTCC GTGATGCATG AGGCTCTGCA CAACCACTAC
    721      ACGCAGAAGA GCCTCTCCCT GTCTCCGGGT AAAGCT2GAGC AGAAACTCAT CTCAGAAGAG
    781      GATCTG3TAA
    
    1. Signal peptide
    2. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression.
    3. Myc Tag
     
    Detect Positive Control Vector Expression by Western Blot

     

    Protocol :
    The 6 µg of plasmid was transfected into 20 ml of HEK293H suspension cells with Sinofection reagent (Cat# STF01). Experssion cells were cultured for 4d at 37°C (5% CO2). The 2×107 of cells were lysed in 1 ml of ice-cold modified RIPA Lysis Buffer with protease inhibitors cocktail (Sigma) by homogenization. The protein concentration of cell lysate was measured by BCA kit, and 1~5 µg of lysate were detected by western blotting using specific anti-tag antibody.
    Size / Price
    Catalog: CV009
    List Price: 
    Price:      (You Save: )
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"