pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)

  • Positive control for the pCMV / hygro-HA.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag) Physical Map

 Vector Name pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag)
 Vector Size


 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)


pCMV / hygro-Positive Control Vector (C-terminal Fc-HA tag) Sequence and Quality Control
781      GCC3TAA
1. Signal peptide
2. GCT was the nucleotide residue from the restriction site during plasmid construction, which has no influence on protein expression.
3. HA Tag
Detect Positive Control Vector Expression by Western Blot


Protocol :
The 6 µg of plasmid was transfected into 20 ml of HEK293H suspension cells with Sinofection reagent (Cat# STF01). Experssion cells were cultured for 4d at 37°C (5% CO2). The 2×107 of cells were lysed in 1 ml of ice-cold modified RIPA Lysis Buffer with protease inhibitors cocktail (Sigma) by homogenization. The protein concentration of cell lysate was measured by BCA kit, and 1~5 µg of lysate were detected by western blotting using specific anti-tag antibody.
Add to Cart Successfully Add to Cart Failed