Quick Order

Text Size:AAA

pCMV / hygro-Negative Control Vector (His-tagged)

DatasheetReviewsRelated ProductsProtocols
  • Negative control for the pCMV / hygro-His clone.
  • sequence is the same as pCMV / hygro-His, except multiple cloning sites are reduced.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV / hygro-Negative Control Vector (His-tagged) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV / hygro-His
 Vector Size

5558bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Ampicillin
 Selection In Mammalian Cells Hygromycin
 Protein Tag CACCATCACCACCATCATCACCACCATCAC
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

 

 
Schematic of pCMV / hygro-Negative Control Vector (His-tagged) Multiple Cloning Sites

Size / Price
Catalog: CV003
List Price: 
Price:      (You Save: )
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"