Quick Order

Text Size:AAA

pCMV / hygro-Negative Control Vector (FLAG-tagged)

    DatasheetReviewsRelated ProductsProtocols
    • Negative control for the pCMV / hygro-FLAG clone.
    • sequence is the same as pCMV / hygro-FLAG, except multiple cloning sites are reduced.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV / hygro-Negative Control Vector (FLAG-tagged) Physical Map
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV / hygro-FLAG
     Vector Size

    5552bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Ampicillin
     Selection In Mammalian Cells Hygromycin
     Protein Tag GATTACAAGGATGACGACGATAAG
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)

     

     
    Schematic of pCMV / hygro-Negative Control Vector (FLAG-tagged) Multiple Cloning Sites

    Size / Price
    Catalog: CV005
    List Price: 
    Price:      (You Save: )
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"