Quick Order

Text Size:AAA

pCMV / hygro-Negative Control Vector (untagged)

    DatasheetReviewsRelated ProductsProtocols
    • Negative control for the untagged-pCMV clone.
    • Vector sequence is the same as pCMV / hygro, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV / hygro-Negative Control Vector (untagged) Physical Map
    Vector Sequence
    Download     
     
    Description
     
     Vector Name  pCMV / hygro-Negative Control Vector (untagged)
     Vector Size

     5504bp

     Vector Type  Mammalian Expression Vector
     Expression Method  Constitutive, Stable / Transient
     Promoter  CMV
     Antibiotic Resistance  Ampicillin
     Selection In Mammalian Cells  Hygromycin
     Protein Tag  None
     Sequencing Primer  Forward:T7(TAATACGACTCACTATAGGG)
     Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV / hygro-Negative Control Vector (untagged) Multiple Cloning Sites

    Size / Price
    Catalog: CV001
    List Price: 
    Price:      (You Save: )
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"