Quick Order

Mouse TNFR2/TNFRSF1B/CD120b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse TNFR2/TNFRSF1B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Mouse
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Mouse TNFR2/TNFRSF1B Gene Plasmid Map
Mouse TNFRSF1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), also known as Tumor necrosis factor receptor 2 (TNFR2) or CD120b antigen, is a member of the tumor necrosis factor receptor superfamily. TNFR2/CD120b/TNFRSF1B is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. TNFR2/CD120b/TNFRSF1B is not a major contributing factor to the genetic risk of type 2 diabetes, its associated peripheral neuropathy and hypertension and related metabolic traits in North Indians. Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B) has been reported to be associated with SLE risk in Japanese populations. TNFR2/CD120b/TNFRSF1B serves as a receptor with high affinity for TNFSF2 and approximately 5-fold lower affinity for homotrimeric TNFSF1. This receptor mediates most of the metabolic effects of TNF-alpha. Isoform 2 blocks TNF-alpha-induced apoptosis, which suggests that it regulates TNF-alpha function by antagonizing its biological activity.

References
  • Komata T, et al. (1999) Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens. 53(6): 527-33.
  • Tsuchiya N, et al. (2001) Analysis of the association of HLA-DRB1, TNFalpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun. 2(6): 317-22.
  • Guo G, et al. (1999) Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol. 277(5): 766-72.
  • Contact Us
    Images
    • Mouse TNFRSF1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"