TBK1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

TBK1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2190 bp
Description
Full length Clone DNA of Mouse TANK-binding kinase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About TBK1

Entrez Gene ID

TBK1 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

1200008B05Rik cDNA ORF Clone, Mouse; AI462036 cDNA ORF Clone, Mouse; AW048562 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait