After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse SRC cDNA Clone Product Information
NCBI RefSeq:NM_009271.3
RefSeq ORF Size:1626bp
cDNA Description:Full length Clone DNA of Mus musculus Rous sarcoma oncogene transcript variant 1 with Flag tag.
Gene Synonym:AW259666, pp60c-src, Src
Restriction Site:HindIII + XhoI (5.4kb + 1.68kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse SRC Gene Plasmid Map
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Mouse SRC Gene Expression validated Image
Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51118-ACG$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51118-ACR$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51118-ANG$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51118-ANR$245
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51118-CF$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagMG51118-CH$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagMG51118-CM$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagMG51118-CY$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone in cloning vectorMG51118-G$75
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagMG51118-NF$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagMG51118-NH$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagMG51118-NM$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagMG51118-NY$215
Mouse SRC/Proto-oncogene c-Src transcript variant 1 Gene ORF cDNA clone expression plasmidMG51118-UT$215
 Learn more about expression Vectors
Product nameProduct name

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.
  • Size / Price
    Catalog: MG51118-G-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    • Mouse SRC Kinase / Proto-oncogene c-Src transcript variant 1 natural ORF mammalian expression plasmid, Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.