MAG cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

MAG cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1749 bp
Description
Full length Clone DNA of Mouse myelin-associated glycoprotein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

MAG cDNA ORF Clone, Mouse, N-DYKDDDDK (Flag®) tag tag: Alternative Names

Gma cDNA ORF Clone, Mouse; siglec-4a cDNA ORF Clone, Mouse

MAG Background Information

The myelin-associated glycoprotein (MAG) contains five immunoglobulin-like domains and belongs to the sialic-acid-binding subgroup of the Ig superfamily. MAG is a transmembrane glycoprotein of 1kDa localized in myelin sheaths of periaxonal Schwann cell and oligodendroglial membranes where it functions in glia-axon interactions. It appears to function both as a receptor for an axonal signal that promotes the differentiation, maintenance and survival of oligodendrocytes and as a ligand for an axonal receptor that is needed for the maintence of myelinated axons. MAG contains a carbohydrate epitope shared with other glycoconjugates that is a target antigen in autoimmune peripheral neuropathy associated with IgM gammopathy and has been implicated in a dying back oligodendrogliopathy in multiple sclerosis. MAG is considered as a transmembrane protein of both CNS and PNS myelin and it strongly inhibits neurite outgrowth in both developing cerebellar and adult dosal root ganglion neurons. In contrast, MAG promotes neurite outgrowth from newborn DRG neurons. Thus, MAG may be responsible for the lack of CNS nerve regeneration and may influce both temporally and spatially regeneration in the PNS.
Full Name
myelin associated glycoprotein
References
  • Quarles RH. (2007) Myelin-associated glycoprotein (MAG): past, present and beyond. J Neurochem. 100(6):1431-48.
  • Mukhopadhyay G, et al. (1994) A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration. Neuron. 13(3): 757-67.
  • Barton DE, et al. (1987) The myelin-associated glycoprotein gene: mapping to human chromosome 19 and mouse chromosome 7 and expression in quivering mice. Genomics. 1(2): 107-12.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait