HBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag

Price:
Size:
Number:

HBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425 bp
Description
Full length Clone DNA of Mouse high mobility group box transcription factor 1 with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag: Alternative Names

1700058O05Rik cDNA ORF Clone, Mouse; BE629963 cDNA ORF Clone, Mouse; C330012F01Rik cDNA ORF Clone, Mouse; C86454 cDNA ORF Clone, Mouse

HBP1 Background Information

HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p3/CBP in two regions: repression domain (K297/35/37) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p3 and CREB-binding protein (CBP) and also recruited p3/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.
Full Name
HMG-box transcription factor 1
References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait