FCER1G cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

FCER1G cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
261 bp
Description
Full length Clone DNA of Mouse Fc receptor, IgE, high affinity I, gamma polypeptide with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FCER1G cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AI573376 cDNA ORF Clone, Mouse; CD23 cDNA ORF Clone, Mouse; Fce1g cDNA ORF Clone, Mouse; FcepsilonRI cDNA ORF Clone, Mouse; FcR-gamma cDNA ORF Clone, Mouse; FcRgamma cDNA ORF Clone, Mouse; FcR[g] cDNA ORF Clone, Mouse; Ly-50 cDNA ORF Clone, Mouse

FCER1G Background Information

Full Name
Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide

FCER1G cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait