C1QC cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

C1QC cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Mouse complement component 1, q subcomponent, C chain with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C1QC cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

AI385742 cDNA ORF Clone, Mouse; C1qg cDNA ORF Clone, Mouse; Ciqc cDNA ORF Clone, Mouse

C1QC Background Information

Full Name
complement component 1, q subcomponent, C chain
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait