MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag

1/1
Price:
Size:
Number:

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag: General Information

Gene
Species
MERS-CoV
NCBI Ref Seq
RefSeq ORF Size
783 bp
Sequence Description
Identical with the Gene Bank AFS88939.1.
Description
Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) orf4b with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.78kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV-orf4b cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MERS-CoV (NCoV / Novel coronavirus) orf4b ORF mammalian expression plasmid, C-HA tag: Validated Images

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait