Quick Order

DatasheetReviewsRelated ProductsProtocols
Human IL27 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human IL27 Gene Plasmid Map
Human interleukin 27 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.

References
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • Images
    • Human interleukin 27 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"