IL-27 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10076-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-27 Reagents
CRO Services

All IL-27 Reagents
IL-27 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
732 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 27 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.76kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL-27 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-27 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human IL-27 Gene Expression validated Image 2385
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
IL-27 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
IL-27 cDNA ORF Clone, Human;IL-27A cDNA ORF Clone, Human;IL27A cDNA ORF Clone, Human;IL27p28 cDNA ORF Clone, Human;IL30 cDNA ORF Clone, Human;p28 cDNA ORF Clone, Human
IL-27 Background Information

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.

Full Name
interleukin 27
References
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • IL-27 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-27 cDNA ORF Clone in Cloning Vector, Rat RG80201-G
    IL-27 cDNA ORF Clone, Rat, untagged RG80201-UT
    IL-27 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80201-ACG
    IL-27 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80201-ACGLN
    IL-27 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80201-ACR
    IL-27 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80201-CF
    IL-27 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80201-NF
    IL-27 cDNA ORF Clone, Rat, C-His tag RG80201-CH
    IL-27 cDNA ORF Clone, Rat, N-His tag RG80201-NH
    IL-27 cDNA ORF Clone, Rat, C-HA tag RG80201-CY
    IL-27 cDNA ORF Clone, Rat, N-HA tag RG80201-NY
    IL-27 cDNA ORF Clone, Rat, C-Myc tag RG80201-CM
    IL-27 cDNA ORF Clone, Rat, N-Myc tag RG80201-NM
    IL-27 qPCR Primer Pairs, Rat RP300193

    IL-27 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-27 cDNA ORF Clone in Cloning Vector, Mouse MG51107-G
    IL-27 cDNA ORF Clone, Mouse, untagged MG51107-UT
    IL-27 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51107-ACG
    IL-27 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51107-ACGLN
    IL-27 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51107-ACR
    IL-27 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51107-CF
    IL-27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51107-NF
    IL-27 cDNA ORF Clone, Mouse, C-His tag MG51107-CH
    IL-27 cDNA ORF Clone, Mouse, N-His tag MG51107-NH
    IL-27 cDNA ORF Clone, Mouse, C-HA tag MG51107-CY
    IL-27 cDNA ORF Clone, Mouse, N-HA tag MG51107-NY
    IL-27 cDNA ORF Clone, Mouse, C-Myc tag MG51107-CM
    IL-27 cDNA ORF Clone, Mouse, N-Myc tag MG51107-NM

    IL-27 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-27 cDNA ORF Clone in Cloning Vector, Human HG10076-M
    IL-27 cDNA ORF Clone, Human, untagged HG10076-UT
    IL-27 cDNA ORF Clone, Human, C-GFPSpark® tag HG10076-ACG
    IL-27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10076-ACGLN
    IL-27 cDNA ORF Clone, Human, C-OFPSpark® tag HG10076-ACR
    IL-27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10076-CF
    IL-27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10076-NF
    IL-27 cDNA ORF Clone, Human, C-His tag HG10076-CH
    IL-27 cDNA ORF Clone, Human, N-His tag HG10076-NH
    IL-27 cDNA ORF Clone, Human, C-HA tag HG10076-CY
    IL-27 cDNA ORF Clone, Human, N-HA tag HG10076-NY
    IL-27 cDNA ORF Clone, Human, C-Myc tag HG10076-CM
    IL-27 cDNA ORF Clone, Human, N-Myc tag HG10076-NM
    IL-27 qPCR Primer Pairs, Human HP100162
    info info
    添加购物车成功! 添加购物车失败!