Quick Order

DatasheetReviewsRelated ProductsProtocols
Human IL12A/P35 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human IL12A/P35 Gene Plasmid Map
Human interleukin 12A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.

  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.
  • Images
    • Human interleukin 12A Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.