Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tag

Price:
Size:
Number:

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tag: General Information

Gene
Species
H1N1
NCBI Ref Seq
RefSeq ORF Size
693 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tag: Alternative Names

NS1 cDNA ORF Clone, H1N1

Nonstructural protein 1 / NS1 Background Information

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.
References
  • Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.
  • Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.
  • Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.
  • Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7

Nonstructural protein 1 / NS1 cDNA ORF Clone, H1N1, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait