Quick Order

Human NPPB Gene ORF cDNA clone expression plasmid

  • Human NPPB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human NPPB cDNA Clone Product Information
NCBI RefSeq:BC025785
RefSeq ORF Size:405bp
cDNA Description:Full length Clone DNA of Homo sapiens natriuretic peptide precursor B.
Gene Synonym:BNP, NPPB
Restriction Site:HindIII + XbaI (5.5kb + 0.41kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with NPPB qPCR primers for gene expression analysis, HP102327 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NPPB Gene Plasmid Map
Human NPPB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG13644-G-N
List Price: 
Price:      (You Save: )
Availability2-3 weeks
Add to CartBulk Discount Inquiry

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.