Interferon alpha 1 / IFNA1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag

Price:
Size:
Number:

Interferon alpha 1 / IFNA1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Human interferon, alpha 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Interferon alpha 1 / IFNA1 cDNA ORF Clone, Human, N-DYKDDDDK (Flag®) tag tag: Alternative Names

IFL cDNA ORF Clone, Human; IFN cDNA ORF Clone, Human; IFN-ALPHA cDNA ORF Clone, Human; IFN-alphaD cDNA ORF Clone, Human; IFNA13 cDNA ORF Clone, Human; IFNA@ cDNA ORF Clone, Human

Interferon alpha 1 / IFNA1 Background Information

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.
Full Name
interferon, alpha 1
References
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.

Interferon alpha 1 / IFNA1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait