LGALS3BP cDNA ORF Clone, Human, C-His tag

Price:
Size:
Number:

LGALS3BP cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Human lectin, galactoside-binding, soluble, 3 binding protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LGALS3BP cDNA ORF Clone, Human, C-His tag: Alternative Names

90K cDNA ORF Clone, Human; BTBD17B cDNA ORF Clone, Human; CyCAP cDNA ORF Clone, Human; gp90 cDNA ORF Clone, Human; M2BP cDNA ORF Clone, Human; MAC-2-BP cDNA ORF Clone, Human; TANGO10B cDNA ORF Clone, Human

LGALS3BP Background Information

Lectin galactoside-binding soluble 3 binding protein (LGALS3BP, also called Mac-2 binding protein) is a heavily glycosylated secreted molecule that has been shown previously to be up-regulated in many cancers and has been implicated in tumor metastatic processes, as well as in other cell adhesion and immune functions. Galectin-3 (Gal-3), coding by LGALS3BP gene, is a protein of the lectin family that has been associated with neoplastic processes and seems to play an important role in a variety of cell biological processes.
Full Name
lectin, galactoside-binding, soluble, 3 binding protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait