Quick Order

DatasheetReviewsRelated ProductsProtocols
Human ErbB2/HER2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human ErbB2/HER2 Gene Plasmid Map
Human ErbB2 / HER2 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Human epidermal growth factor receptor 2 (HER2), also known as ErbB2, NEU, and CD340, is a type I membrane glycoprotein, and belongs to the epidermal growth factor (EGF) receptor family. HER2 protein cannot bind growth factors due to the lacking of ligand binding domain of its own and autoinhibited constitutively. However, HER2 forms a heterodimer with other ligand-bound EGF receptor family members, therefore stabilizes ligand binding and enhances kinase-mediated activation of downstream molecules. HER2 plays a key role in development, cell proliferation and differentiation. HER2 gene has been reported to associate with malignancy and a poor prognosis in numerous carcinomas, including breast, prostate, ovarian, lung cancers and so on.

References
  • Krawczyk N, et al. (2009) HER2 status on persistent disseminated tumor cells after adjuvant therapy may differ from initial HER2 status on primary tumor. Anticancer Res. 29(10): 4019-24.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"