DBI cDNA ORF Clone, Human, N-OFPSpark® tag

Price:
Size:
Number:

DBI cDNA ORF Clone, Human, N-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
315 bp
Description
Full length Clone DNA of Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) with N terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DBI cDNA ORF Clone, Human, N-OFPSpark® tag: Alternative Names

ACBD1 cDNA ORF Clone, Human; ACBP cDNA ORF Clone, Human; CCK-RP cDNA ORF Clone, Human

DBI Background Information

The diazepam binding inhibitor (DBI), alternatively known as the acyl-CoA binding protein (ACBP), is involved in multiple biological actions. The polypeptide binds to the peripheral, or mitochondrial, benzodiazepine receptor and facilitates transport of cholesterol to the inner membrane to stimulate steroid synthesis. Through this action, DBI indirectly modulates gamma-aminobutyric acid (GABA)-mediated inhibitory neurotransmission. DBI can be postulated as a candidate gene for psychiatric phenotypes including anxiety, mood, and psychotic disorders. Diazepam Binding Inhibitor (DBI), also called acyl-CoA binding protein (ACBP), is a ubiquitously expressed protein originally identified based on its ability to displace diazepam from its binding site on the GABAA receptor. The mutant allele of the DBI was one of the risk factors for alcohol dependence as for the rs2276596 polymorphism.
Full Name
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait