Text Size:AAA

Human CROT Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CROT cDNA Clone Product Information
NCBI RefSeq:NM_021151.2
RefSeq ORF Size:1839bp
cDNA Description:Full length Clone DNA of Homo sapiens carnitine O-octanoyltransferase with Flag tag.
Gene Synonym:ARP2, HARP, MGC8889, ANGPTL2
Restriction Site:KpnI + XhoI (5.4kb + 1.89kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1420G/C not causing the amino acid variation.
( We provide with CROT qPCR primers for gene expression analysis, HP100976 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CROT Gene Plasmid Map
Human CROT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • Size / Price
    Catalog: HG11015-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry
    Contact Us
    • Human CROT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.