HBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

HBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1545 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens HMG-box transcription factor 1.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

HBP1 Background Information

HBP1 is a sequence-specific DNA-binding transcription factor. It is involved in many biological processes. It was reported that HBP1 binds to p16(INK4A) promoter and activates p16(INK4A) expression. We found that trichostatin A (TSA), an inhibitor of HDAC (histone deacetylase), induces p16(INK4A) expression in an HBP1-dependent manner. HBP1 activates or represses the expression of some specific genes during cell growth and differentiation. HBP1 was acetylated by p3/CBP in two regions: repression domain (K297/35/37) and P domain (K171/419). HBP1 acetylation after TSA treatment was confirmed by immunoprecipitation assay. HBP1 interacted with histone acetyltransferase p3 and CREB-binding protein (CBP) and also recruited p3/CBP to p16(INK4A) promoter. HBP1 acetylation at K419 plays an important role in HBP1-induced p16(INK4A) expression.
Full Name
HMG-box transcription factor 1
References
  • Tevosian SG. et al., 1997, Genes Dev. 11 (3): 383-96.
  • Lavender P. et al., 1997, Oncogene. 14 (22): 2721-8.
  • Swanson. et al., 2004, Nat Struct Mol Biol. 11 (8): 738-46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait