Quick Order

Text Size:AAA

Human GSK3B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human GSK3B cDNA Clone Product Information
NCBI RefSeq:NM_001146156.1
RefSeq ORF Size:1263
cDNA Description:ORF Clone of Homo sapiens glycogen synthase kinase 3 beta DNA.
Gene Synonym:GSK3B
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Human GSK3B Gene Plasmid Map
Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.
  • Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.
  • Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.
  • Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.
  • Contact Us
    • Human glycogen synthase kinase 3 beta Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.