EpCAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

EpCAM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
948 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus epithelial cell adhesion molecule.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

EpCAM Background Information

Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â…transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.
Full Name
epithelial cell adhesion molecule
References
  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.

EpCAM cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait