eIF4E cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10033-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All eIF4E Reagents
CRO Services

All eIF4E Reagents
eIF4E cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 4E DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
eIF4E cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF4E cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
eIF4E cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
AUTS19 cDNA ORF Clone, Human;CBP cDNA ORF Clone, Human;EIF4E1 cDNA ORF Clone, Human;EIF4EL1 cDNA ORF Clone, Human;EIF4F cDNA ORF Clone, Human
eIF4E Background Information
Full Name
eukaryotic translation initiation factor 4E

eIF4E cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eIF4E cDNA ORF Clone in Cloning Vector, Rat RG81113-U
eIF4E cDNA ORF Clone, Rat, untagged RG81113-UT
eIF4E Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81113-ACGLN
eIF4E cDNA ORF Clone, Rat, C-GFPSpark® tag RG81113-ACG
eIF4E cDNA ORF Clone, Rat, N-GFPSpark® tag RG81113-ANG
eIF4E cDNA ORF Clone, Rat, C-OFPSpark® tag RG81113-ACR
eIF4E cDNA ORF Clone, Rat, N-OFPSpark® tag RG81113-ANR
eIF4E cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81113-CF
eIF4E cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81113-NF
eIF4E cDNA ORF Clone, Rat, C-His tag RG81113-CH
eIF4E cDNA ORF Clone, Rat, N-His tag RG81113-NH
eIF4E cDNA ORF Clone, Rat, C-HA tag RG81113-CY
eIF4E cDNA ORF Clone, Rat, N-HA tag RG81113-NY
eIF4E cDNA ORF Clone, Rat, C-Myc tag RG81113-CM
eIF4E cDNA ORF Clone, Rat, N-Myc tag RG81113-NM
eIF4E qPCR Primer Pairs, Rat RP301070

eIF4E cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eIF4E cDNA ORF Clone in Cloning Vector, Mouse MG57817-U
eIF4E cDNA ORF Clone, Mouse, untagged MG57817-UT
eIF4E cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57817-ACG
eIF4E Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57817-ACGLN
eIF4E cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57817-ANG
eIF4E cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57817-ACR
eIF4E cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57817-ANR
eIF4E cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57817-CF
eIF4E cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57817-NF
eIF4E cDNA ORF Clone, Mouse, C-His tag MG57817-CH
eIF4E cDNA ORF Clone, Mouse, N-His tag MG57817-NH
eIF4E cDNA ORF Clone, Mouse, C-HA tag MG57817-CY
eIF4E cDNA ORF Clone, Mouse, N-HA tag MG57817-NY
eIF4E cDNA ORF Clone, Mouse, C-Myc tag MG57817-CM
eIF4E cDNA ORF Clone, Mouse, N-Myc tag MG57817-NM

eIF4E cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF4E cDNA ORF Clone in Cloning Vector, Human HG10033-M
eIF4E cDNA ORF Clone, Human, untagged HG10033-UT
eIF4E Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10033-ACGLN
eIF4E cDNA ORF Clone, Human, C-GFPSpark® tag HG10033-ACG
eIF4E cDNA ORF Clone, Human, N-GFPSpark® tag HG10033-ANG
eIF4E cDNA ORF Clone, Human, C-OFPSpark® tag HG10033-ACR
eIF4E cDNA ORF Clone, Human, N-OFPSpark® tag HG10033-ANR
eIF4E cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10033-CF
eIF4E cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10033-NF
eIF4E cDNA ORF Clone, Human, C-His tag HG10033-CH
eIF4E cDNA ORF Clone, Human, N-His tag HG10033-NH
eIF4E cDNA ORF Clone, Human, C-HA tag HG10033-CY
eIF4E cDNA ORF Clone, Human, N-HA tag HG10033-NY
eIF4E cDNA ORF Clone, Human, C-Myc tag HG10033-CM
eIF4E cDNA ORF Clone, Human, N-Myc tag HG10033-NM
eIF4E qPCR Primer Pairs, Human HP100127
info info
添加购物车成功! 添加购物车失败!