eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 1.79kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2A/eIF2 alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CDA02 cDNA ORF Clone, Human; EIF-2A cDNA ORF Clone, Human; MST089 cDNA ORF Clone, Human; MSTP004 cDNA ORF Clone, Human; MSTP089 cDNA ORF Clone, Human

eIF2A/eIF2 alpha Background Information

Full Name
eukaryotic translation initiation factor 2A, 65kDa
Add to Cart Successfully Add to Cart Failed