eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10112-M-F

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All eIF2A/eIF2 alpha Reagents

CRO Services


All eIF2A/eIF2 alpha Reagents

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human eukaryotic translation initiation factor 2A, 65kDa (EIF2A) with Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 1.79kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF2A/eIF2 alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human G-CSF/CSF3 Gene Plasmid Map 7153

eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

CDA02 cDNA ORF Clone, Human;EIF-2A cDNA ORF Clone, Human;MST089 cDNA ORF Clone, Human;MSTP004 cDNA ORF Clone, Human;MSTP089 cDNA ORF Clone, Human

eIF2A/eIF2 alpha Background Information

Full Name
eukaryotic translation initiation factor 2A, 65kDa

eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone in Cloning Vector, Ferret FG60129-G
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, untagged FG60129-UT
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60129-ACGLN
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60129-ACG
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60129-ANG
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60129-ACR
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60129-ANR
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60129-CF
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60129-NF
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-His tag FG60129-CH
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-His tag FG60129-NH
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-HA tag FG60129-CY
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-HA tag FG60129-NY
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, C-Myc tag FG60129-CM
eIF2A/eIF2 alpha cDNA ORF Clone, Ferret, N-Myc tag FG60129-NM

eIF2A/eIF2 alpha cDNA ORF Clone, Danio rerio (zebrafish), Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone, Danio rerio (zebrafish), untagged ZG63005-UT
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Danio rerio (zebrafish), C-GFPSpark® tag ZG63005-ACGLN

eIF2A/eIF2 alpha cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eIF2A/eIF2 alpha cDNA ORF Clone in Cloning Vector, Human HG10112-M
eIF2A/eIF2 alpha cDNA ORF Clone, Human, untagged HG10112-UT
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG10112-ACG
eIF2A/eIF2 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10112-ACGLN
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG10112-ANG
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG10112-ACR
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG10112-ANR
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10112-CF
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10112-NF
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-His tag HG10112-CH
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-His tag HG10112-NH
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-HA tag HG10112-CY
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-HA tag HG10112-NY
eIF2A/eIF2 alpha cDNA ORF Clone, Human, C-Myc tag HG10112-CM
eIF2A/eIF2 alpha cDNA ORF Clone, Human, N-Myc tag HG10112-NM
eIF2A/eIF2 alpha qPCR Primer Pairs, Human HP100187
info info
添加购物车成功! 添加购物车失败!