Quick Order

Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV RSV-F cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1725bp
cDNA Description:Full length Clone DNA of Human RSV (subtype A, strain A2) Fusion glycoprotein / RSV-F.
Gene Synonym:F, HRSVgp08
Species:RSV
Vector:Vector 3
Plasmid:pCDNA3-RSV-F(A-A2)
Restriction Site:KpnI + XbaI (5.4kb + 1.73kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P03420.
Sequencing primers:Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAA
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Vector 3 Information

The Vector 3 is 5.4kb in length, and contains the the amplicin resistance gene, conferring selection of the plasmid in E. coli., the kanamycin resistance gene (neomycin for mammalian selection), and the CMV promoter upstream of the cDNA insert. The SV40 origin allows for replication in mammalian cells, the ColE1 origin is the bacterial origin of replication, and the f1 origin is the filamentous phage origin of replication. The plasmid has multiple cloning sites as shown below. NOTE: the restriction enzymes used in each vector 3 clone is indicated in the product datasheet.

Vector 3 Usage Suggestion

The coding sequence can be easily obtained by digesting the vector with proper restriction enzyme(s). The coding sequence can also be amplified by PCR with primer pair SP6 and T7.

Vector Sequence Download
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized) on other vectors
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40042-ACG$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40042-ACR$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, His tagVG40042-C-H$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40042-CF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40042-CH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40042-CM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40042-CY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40042-NF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40042-NH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40042-NM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40042-NY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F ORF mammalian expression plasmid (Codon Optimized)VG40042-UT$315
 Learn more about expression Vectors
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"