Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-FcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG40042-ACG$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG40042-ACR$345
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG40042-C$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, His-taggedVG40042-C-H$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40042-CF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40042-CH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40042-CM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40042-CY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40042-NF$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40042-NH$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40042-NM$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40042-NY$315
Human respiratory syncytial virus (RSV) (subtype A, strain A2) Fusion glycoprotein / RSV-F Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40042-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. The G protein mediates attachment of the virus to cell surface receptors, while the F protein promotes fusion of the viral and cellular membranes, allowing entry of the virus ribonucleoprotein into the cell cytoplasm. The fusion (F) protein of RSV is synthesized as a nonfusogenic precursor protein (F0), which during its migration to the cell surface is activated by cleavage into the disulfide-linked F1 and F2 subunits. This fusion is pH independent and occurs directly at the outer cell membrane, and the F2 subunit was identifed as the major determinant of RSV host cell specificity. The trimer of F1-F2 interacts with glycoprotein G at the virion surface. Upon binding of G to heparan sulfate, the hydrophobic fusion peptide is unmasked and induces the fusion between host cell and virion membranes. Notably, RSV fusion protein is unique in that it is able to interact directly with heparan sulfate and therefore is sufficient for virus infection. Furthermore, the fusion protein is also able to trigger p53-dependent apoptosis.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 (3): 453-8.
  • Jose A M. et al., 1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73 (8): 6610-7.
  • Zlateva K.T. et al., 2004, J Virol. 78 (9): 4675-83.
  • Trento A. et al., 2006, J Virol. 80 (2): 975-84.
  • Branigan P J. et al., 2006, J Gen Virol. 87 (2): 395-8.
  • Eckardt-Michel J. et al., 2008, J. Virol. 82: 3236-49.
  • Size / Price
    Images
    • Human RSV Fusion glycoprotein / RSV-F A2 strain (subtype A) Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"