Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RSV-GcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40038-ACG$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-OFPSpark tagVG40038-ACR$325
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG40038-CF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG40038-CH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG40038-CM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG40038-CY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone)VG40038-G$95
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG40038-NF$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG40038-NH$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG40038-NM$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG40038-NY$295
Human respiratory syncytial virus (RSV) (subtype A, strain A2) glycoprotein G / RSV-G Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG40038-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Human respiratory syncytial virus (HRSV) is the most common etiological agent of acute lower respiratory tract disease in infants and can cause repeated infections throughout life. It is classified within the genus pneumovirus of the family paramyxoviridae. Like other members of the family, HRSV has two major surface glycoproteins (G and F) that play important roles in the initial stages of the infectious cycle. HRSV G protein is a type II glycoprotein of 289-299 amino acids (depending on the virus strain) with a signal/anchor hydrophobic domain and is extensively modified by the addition of both N-and O-linked oligosaccharides to achieve the mature form of 80-90 kDa. The C-terminal ectodomain of the G protein has a central region and four cysteines which are conserved in all HRSV isolates and have been proposed as the putative receptor binding site. The G protein mediates attachment of the virus to the host cell membrane by interacting with heparan sulfate, initiating the infection. As similar to mucins in amino acid compositions, the RSV G protein can interact with host CX3CR1, the receptor for the CX3C chemokine fractalkine, and thus modulates the immune response and facilitate infection. Secreted glycoprotein G helps RSV escape antibody-dependent restriction of replication by acting as an antigen decoy and by modulating the activity of leukocytes bearing Fcgamma receptors. Unlike the other paramyxovirus attachment proteins, HRSV-G lacks both neuraminidase and hemagglutinating activities.

References
  • Martin-Gallardo A. et al., 1993, J Gen Virol. 74 : 453-8.
  • Jose AM. et al.,1997, J Gen Virol. 78: 2411-8.
  • Feldman SA. et al., 1999, J Virol. 73: 6610-7.
  • García-Beato R. et al., 2000, J Gen Virol. 81: 919-27.
  • Zlateva KT. et al., 2004, J Virol. 78: 4675-83.
  • Trento A. et al., 2006, J Virol. 80: 975-84.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"