After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40001-ACG$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40001-ACR$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-C$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40001-CF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40001-CH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40001-CM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40001-CY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag tagVG40001-NF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40001-NH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40001-NM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40001-NY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UT$315
 Learn more about expression Vectors
Product nameProduct name
Images
  • Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"