Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40001-ACG$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40001-ACR$345
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmidVG40001-C$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40001-CF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40001-CH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40001-CM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40001-CY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Flag tagVG40001-NF$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40001-NH$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40001-NM$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40001-NY$315
Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40001-UT$315
 Learn more about expression Vectors
Product nameProduct name
  • Influenza A H5N1 (A/Duck/Hong Kong/p46/97) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items