After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
H12N5 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1695bp
cDNA Description:Full length Clone DNA of Influenza A H12N5 (A/green-winged teal/ALB/199/1991) HA DNA.
Gene Synonym:HA1, Hemagglutinin
Species:H12N5
Vector:pCMV/hygro-FLAG
Plasmid:pCMV-H12N5-GA-91-HA-flag
Restriction Site:KpnI + XhoI (5.5kb + 1.73kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABB88110.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H12N5 HA Gene Plasmid Map
Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11718-ACG$345
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11718-ACR$345
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-C$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11718-CF$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11718-CH$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11718-CM$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11718-CY$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11718-NF$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11718-NH$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11718-NM$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11718-NY$315
Influenza A H12N5 (A/green-winged teal/ALB/199/1991 ) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11718-UT$315
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"