After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza B (B/Malaysia/2506/2004) Hemagglutinin natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Influenza B HA cDNA Clone Product Information
RefSeq ORF Size:1758bp
cDNA Description:Full length Clone DNA of Influenza B (B/Malaysia/2506/2004) HA with HA tag.
Gene Synonym:HA1, Hemagglutinin
Species:Influenza B
Restriction Site:HindIII + XhoI (5.5kb + 1.79kb)
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACO05957.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-HA Vector Information
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Influenza B (B/Malaysia/2506/2004) Hemagglutinin natural ORF mammalian expression plasmid, HA tag on other vectors
Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11716-ACG$345
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11716-ACR$345
Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-C$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11716-CF$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11716-CH$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11716-CM$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11716-CY$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11716-NF$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11716-NH$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11716-NM$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11716-NY$315
Influenza B (B/Malaysia/2506/2004) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11716-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11716-C-Y
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions