Quick Order

Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
RefSeq ORF Size:1707bp
cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin DNA.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:KpnI + XbaI (5.5kb + 1.71kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABQ45850.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N1 HA Gene Plasmid Map
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin natural ORF mammalian expression plasmid on other vectors
Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11712-ACG$345
Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11712-ACR$345
Influenza A H5N1 (A/chicken/India/NIV33487/06) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11712-C$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11712-CF$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11712-CH$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11712-CM$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11712-CY$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11712-NF$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11712-NH$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11712-NM$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11712-NY$315
Influenza A H5N1 (A/chicken/India/NIV33487/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11712-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11712-C-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions