Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11702-ACG$345
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11702-ACR$345
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11702-C$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11702-CF$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11702-CH$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11702-CM$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11702-CY$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11702-NF$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11702-NH$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11702-NM$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11702-NY$315
Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11702-UT$315
 Learn more about expression Vectors
Product nameProduct name
  • Influenza A H5N1 (A/Egypt/N05056/2009) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items