After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HAcDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-GFPSpark-tagged, expression readyVG11700-ACG$345
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, expression ready, C-OFPSpark tagVG11700-ACR$345
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression readyVG11700-C$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-FLAG-taggedVG11700-CF$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-His-taggedVG11700-CH$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-Myc-taggedVG11700-CM$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, C-HA-taggedVG11700-CY$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-FLAG-taggedVG11700-NF$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-His-taggedVG11700-NH$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-Myc-taggedVG11700-NM$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, N-HA-taggedVG11700-NY$315
Influenza A H5N1 (A/Common magpie/Hong Kong/2256/2006) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untaggedVG11700-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name