Quick Order

Text Size:AAA

Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N2 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1717bp
cDNA Description:Full length Clone DNA of Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin.
Gene Synonym:HA1, Hemagglutinin
Vector:Vector 3
Restriction Site:HindIII + XbaI (5.4kb + 1.72kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACF47563.1.
Sequencing primers:Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAA
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N2 HA Gene Plasmid Map
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready
Vector 3 Information

The Vector 3 is 5.4kb in length, and contains the the amplicin resistance gene, conferring selection of the plasmid in E. coli., the kanamycin resistance gene (neomycin for mammalian selection), and the CMV promoter upstream of the cDNA insert. The SV40 origin allows for replication in mammalian cells, the ColE1 origin is the bacterial origin of replication, and the f1 origin is the filamentous phage origin of replication. The plasmid has multiple cloning sites as shown below. NOTE: the restriction enzymes used in each vector 3 clone is indicated in the product datasheet.

Vector 3 Usage Suggestion

The coding sequence can be easily obtained by digesting the vector with proper restriction enzyme(s). The coding sequence can also be amplified by PCR with primer pair SP6 and T7.

Vector Sequence Download
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11699-ACG$345
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11699-ACR$345
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11699-CF$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11699-CH$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11699-CM$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11699-CY$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11699-NF$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11699-NH$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11699-NM$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11699-NY$315
Influenza A H5N2 (A/American green-winged teal/California/HKWF609/07) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11699-UT$315
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.