Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11697-ACG$345
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11697-ACR$345
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11697-C$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11697-CF$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11697-CH$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11697-CM$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11697-CY$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11697-NF$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11697-NH$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11697-NM$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11697-NY$315
Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11697-UT$315
 Learn more about expression Vectors
Product nameProduct name
Images
  • Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"