After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11686-ACG$345
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11686-ACR$345
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11686-C$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11686-CF$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11686-CH$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11686-CM$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11686-CY$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11686-NF$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11686-NH$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11686-NM$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11686-NY$315
Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11686-UT$315
 Learn more about expression Vectors
Product nameProduct name
  • Influenza A H5N1 (A/chicken/Egypt/2253-1/2006) Hemagglutinin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items