Quick Order

Text Size:AAA

Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin with Flag tag.
Gene Synonym:HA1, Hemagglutinin
Restriction Site:KpnI + XhoI (5.5kb + 1.73kb)
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABD77675.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H1N1 HA Gene Plasmid Map
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, Flag tag on other vectors
Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11684-ACG$345
Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11684-ACR$345
Influenza A H1N1 (A/Puerto Rico/8/34) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11684-C$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11684-CF$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11684-CH$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11684-CM$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11684-CY$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11684-NF$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11684-NH$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11684-NM$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11684-NY$315
Influenza A H1N1 (A/Puerto Rico/8/1934) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11684-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG11684-C-F
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.