After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/New Caledonia/20/99) HA.
Gene Synonym:HA1, Hemagglutinin
Vector:Vector 3
Restriction Site:HindIII + XbaI (5.4kb + 1.7kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAP34324.1.
Sequencing primers:Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAA
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Vector 3 Information

The Vector 3 is 5.4kb in length, and contains the the amplicin resistance gene, conferring selection of the plasmid in E. coli., the kanamycin resistance gene (neomycin for mammalian selection), and the CMV promoter upstream of the cDNA insert. The SV40 origin allows for replication in mammalian cells, the ColE1 origin is the bacterial origin of replication, and the f1 origin is the filamentous phage origin of replication. The plasmid has multiple cloning sites as shown below. NOTE: the restriction enzymes used in each vector 3 clone is indicated in the product datasheet.

Vector 3 Usage Suggestion

The coding sequence can be easily obtained by digesting the vector with proper restriction enzyme(s). The coding sequence can also be amplified by PCR with primer pair SP6 and T7.

Vector Sequence Download
Influenza A H1N1 (A/New Caledonia/20/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG11683-C
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions