Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
gp120cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

The HIV-1 gp120 envelope protein, a glycoprotein that is part of the outer layer of the virus, which is an essential component in the multi-tiered viral entry process. It presents itself as viral membrane spikes consisting of 3 molecules of gp120 linked together and anchored to the membrane by gp41 protein. Gp120 is essential for viral infection as it facilitates HIV entry into the host cell and this is its best-known and most researched role in HIV infection. However, it is becoming increasingly evident that gp120 might also be facilitating viral persistence and continuing HIV infection by influencing the T cell immune response to the virus. The surface protein gp120 attaches the virus to the host lymphoid cell by binding to the primary receptor CD4. Gp120 binding to its receptor CD4 and co-receptor, CXCR4 or CCR5 is required for fusion of viral and cellular membranes. Several mechanisms might be involved in this process of which gp120 binding to the CD4 receptor of T cells is the best known and most important interaction as it facilitates viral entry into the CD4+ cells and their depletion, a hallmark of the HIV infection. Gp120 is shed from the viral membrane and accumulates in lymphoid tissues in significant amounts. Despite the overall genetic heterogeneity of the gp120 glycoprotein, the conserved CD4 binding site provides an attractive antiviral target. Interaction between gp120 and ITGA4/ITGB7 would allow the virus to enter GALT early in the infection, infecting and killing most of GALT's resting CD4+ T-cells. This T-cell depletion is believed to be the major insult to the host immune system leading to AIDS.

References
  • Kadow J, et al. (2006) Small-molecule HIV-1 gp120 inhibitors to prevent HIV-1 entry: an emerging opportunity for drug development. Curr Opin Investig Drugs. 7(8): 721-6.
  • Stevceva L, et al. (2007) Immune responses to HIV Gp120 that facilitate viral escape. Curr HIV Res. 5(1): 47-54.
  • Yoon V, et al. (2010) The GP120 molecule of HIV-1 and its interaction with T cells. Curr Med Chem. 17(8): 741-9.
  • Size / Price
    Images
    • HIV-1 GP120 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"