Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
H7N7 HA cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
H7N7 HA Gene Plasmid Map
Influenza A H7N7 (A/Netherlands/219/2003) Hemagglutinin partial Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Influenza A H7N7 (A/Netherlands/219/2003) Hemagglutinin partial Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
Recently Viewed Items