After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ALK-3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human TGFB1 (LAP) / TGF-beta 1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman ALK-2 / ACVR1 Protein (His & Fc Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human TGFBR2 Protein (His & Fc Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human ALK4 / ACVR1B Protein (His Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human BAMBI / NMA Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Human ATF2 Protein (His & GST Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinRat Cripto / TDGF1 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Rhesus ACVR1B / ALK-4 Protein (Fc Tag)Mouse BAMBI / NMA Protein (Fc Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rhesus TGFBR2 Protein (Fc Tag)Rhesus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Mouse Smad5 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

  • Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.
  • Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.
  • Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.
  • Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.
  • Images
    • Rat BMPR1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items