After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse EGFR ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse EGFR/ErbB1/HER1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (His Tag)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman EGFL6 / EGF-L6 Protein (Flag & His Tag)Human HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Mouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinRhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinHuman EGFL7 / VE-statin Protein (His Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.