Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IL22 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • Images
    • Mouse IL22 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items