Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IL3Ra cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Mouse IL3Ra Gene Plasmid Map
Mouse IL3Ra Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Rhesus CD122 / IL-2RB Protein (Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Rhesus CD122 / IL-2RB Protein (His Tag)Mouse IL7 / Interleukin 7 ProteinMouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-21 / IL-21 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Rat IL9R / Interleukin 9 receptor Protein (His Tag)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinMouse IL21 / Interleukin 21 ProteinCanine IL21 / Interleukin 21 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag)Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Human IL7 / interleukin 7 ProteinRat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Rhesus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL21 / Interleukin 21 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Rat IL7 / interleukin 7 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-15 / IL15 / Interleukin 15 ProteinHuman IL-8 / CXCL8 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • Images
    • Mouse IL3Ra Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items