After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse FZD5 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse Frizzled-5/FZD5 cDNA Clone Product Information
Gene_bank_ref_id:NM_001042659.1
RefSeq ORF Size:1758bp
cDNA Description:Full length Clone DNA of Mus musculus frizzled homolog 5 (Drosophila) with His tag.
Gene Synonym:Fz5, Fz-5, mFz5, AI427138, MGC141642, 5330434N09Rik, Fzd5
Species:Mouse
Vector:pCMV/hygro-His
Plasmid:pCMV-mFZD5-10his
Restriction Site:KpnI + XhoI (5.5kb + 1.79kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 10 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt10B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.

Size / Price
Catalog: MG50772-G-H
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"