After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PARP1cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Poly (ADP-ribose) polymerase 1(PRAP1), also known as NAD(+) ADP-ribosyltransferase 1(ADPRT), is a chromatin-associated enzyme which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The ADP-D-ribosyl group of NAD+ is transferred to an acceptor carboxyl group on a histone or the enzyme itself, and further ADP-ribosyl groups are transferred to the 2'-position of the terminal adenosine moiety, building up a polymer with an average chain length of 20-30 units. The poly(ADP-ribosyl)ation modification is critical for a wide range of processes, including DNA repair, regulation of chromosome structure, transcriptional regulation, mitosis and apoptosis. PARP1 is demonstrateed to mediate the poly(ADP-ribose) ation of APLF (aprataxin PNK-like factor) and CHFR (checkpoint protein with FHA and RING domains), two representative proteins involved in the DNA damage response and checkpoint regulation. Further, It has been suggested that DNA-dependent protein kinase (DNA-PK), another component of DNA repair, suppresses PARP activity, probably through direct binding and/or sequestration of DNA-ends which serve as an important stimulator for both enzymes. PARP1 inhibitors is thus proposed as a targeted cancer therapy for recombination deficient cancers, such as BRCA2 tumors.

  • Malanga M. et al., 1998, J Biol Chem. 273: 11839-11843.
  • Ariumi Y. et al., 1999, Oncogene. 18: 4616-4625.
  • Helleday T. et al., 2005, Cell Cycle. 4: 1176-1178.
  • Ahell I. et al., 2008, Nature. 451: 81-85.
  • Size / Price
    • Mouse PARP1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items